***Installing needed tools**********************************************************************************

***Important note: If linux is not recognizing your commands, ensure they are in the search path of the shell. You can safely temporarily add the 
        present working directory (pwd) using the command:
            
            export PATH=$PATH:$(pwd)

Before moving on it may help to make sure you have "make" installed,
    "build-essential" installed, and the Zlib 
    development package
    
    sudo apt install make
    sudo apt install build-essential
    sudo apt install zlib1g-dev

---Installing fastqc in Ubuntu/Linux

	sudo apt install fastqc

---Installing cutadapt

	sudo apt install cutadapt

---Installing STACKS

Download the STACKS software from the website

    https://catchenlab.life.illinois.edu/stacks/
    
In linux (I'm using the Ubuntu app on Windows 11) navigate to the directory 
    containing the downloaded file. In this directory we will unpack and install
    the program using the below commands found on the website below
    
    https://catchenlab.life.illinois.edu/stacks/manual/#install
    
    tar xfvz stacks-2.xx.tar.gz    #Replace x's with your version number
    cd stacks-2.xx
    ./configure --prefix=/home/jes8x/       #the --prefix option will allow you
    make                                        specifiy the directory where
                                                STACKS will be installed. For me this     
    make install                                is my /home/jes8x/ directory
    

***Using installed tools**************************************************************************************

Find and unzip 2b-RAD sequences (For this using only the forward reads of my Symbiodinium sequences)
    Make a folder on your desktop and place these sequences into it
    Change the names of the files if it helps simplify typing them, BUT keep sequence identifiers with each sequence
    Remove any files from folder that do not have any data in them (i.e. 0 bytes)
    

    
Create a text file (.txt) in this folder titled "popmap.txt" **I had to make this in notepad for it to work properly
    For my analysis I did not know the population distributions so I placed each samples into a seperate population
        Format it with Sample_name<tab>population#
        **Make sure these names match your sample sequence file names exactly
        Here is an example of how to format it:
        
        JES201  1
        JES202  2
        JES203  3
        JES204  4
        JES205  5
        JES206  6
        
In your stacks directory make a directory name "samples," "popmaps," and "stacks"

    mkdir samples
    mkdir popmaps
    mkdir stacks        

        
Copy sequence files to the "samples" directory in the stacks directoy
Copy the popmap to "popmaps" directory in stacks directory
	examples of copying files from one directory to another:
	
	cp JES201.fastq /home/jes8x/stacks/samples	#This moves the file "JES201" from the current directory to the samples
								directory inside of the stacks directory

While in the samples directory run cutadapt on each samples using the following command line input to get ONLY 36bp fragments
    The adapter in the input is the forward adapter used in our 2b-RAD sequencing run for the forward reads 
    
    cutadapt command:
    
    cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -m 36 -M 36 -o JES2016_R1_36bp_trim.fastq JES2016_R1.fastq
    
    Make sure to copy the files back to the desktop folder so you can open them graphically
    Also, move untrimmed sequences out of the "samples" directory in stacks
    
-------------Quality check--------------


Once fastqc is installed navigate to the directory containing your trimmed sequence files and run the command for fastqc
    Command for running fastqc in ubuntu(linux):
    
        fastqc *36bp_trim.fastq
        
        The "*" runs the command as a wild card and will search for any file ending with this
        The output of the fastqc html will be in the folder/directory where your samples are imported from 
        
 
------------Aligning Using a Denovo reference

Ensure trimmed sample sequences are in the samples directory and the popmap is in the popmaps directory

    Once sequences and popmap are in the correct directories and stacks directory is made, run the denovomap program using the below command:
        
        denovo_map.pl -T 8 -M 4 -o ./stacks/ --samples ./samples --popmap ./popmaps/popmap.txt
        

-----------Exporting alignments-----------

    When exporting for use in R and PCAs you want to export as genpop file. This is because structure outputs make two entries for each sample and this
        is not compatible with creating a data frame in R
        
    
Exporting in genpop:

    populations -P ./stacks --genepop -M ./popmaps/popmap.txt -O /mnt/c/users/ranou/desktop/GenePop_out     # -O indicates where you want the output to go
    
    
Exporting for structure

    populations -P ./stacks -M ./popmaps/popmap.txt -O /mnt/c/users/ranou/desktop/Structure_out --write-single-snp --structure     #structure does not like linked SNPs so 
                                                                                                                                    we also use the option "-write_single_snp" 
                                                                                                                                    to write only one SNP per locus
                                                                                                                                    #Also be aware that the guide to stacks says   
                                                                                                                                        the command is --write_single_snp but the command
                                                                                                                                        is actually --write-single-snp
                                                        
            *Once you have the populations.structure output file make sure to remove the first line of the file or else structure will not recognize it


Exporting in phylip format
    
    populations -P ./stacks --phylip -M ./popmaps/popmap.txt -O /mnt/c/users/ranou/desktop/Zoa_Phylip